Transcript: Human NM_000734.4

Homo sapiens CD247 molecule (CD247), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
CD247 (919)
Length:
1597
CDS:
65..556

Additional Resources:

NCBI RefSeq record:
NM_000734.4
NBCI Gene record:
CD247 (919)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000734.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057229 CGAAGAGAGGAGTACGATGTT pLKO.1 299 CDS 100% 4.950 3.960 N CD247 n/a
2 TRCN0000057231 CTACAGTGAGATTGGGATGAA pLKO.1 427 CDS 100% 4.950 3.465 N CD247 n/a
3 TRCN0000057232 CTTGTTCCTGAGAGTGAAGTT pLKO.1 208 CDS 100% 4.950 3.465 N CD247 n/a
4 TRCN0000057230 GCAGAAAGATAAGATGGCGGA pLKO.1 403 CDS 100% 0.540 0.378 N CD247 n/a
5 TRCN0000057228 CCAGCTCTATAACGAGCTCAA pLKO.1 271 CDS 100% 0.405 0.284 N CD247 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000734.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00246 pDONR223 100% 99.3% 99.3% None 299_300insGCA n/a
2 ccsbBroad304_00246 pLX_304 0% 99.3% 99.3% V5 299_300insGCA n/a
3 TRCN0000478314 CGTTCCCGTATCATATAGTTCAAT pLX_317 43.3% 99.3% 99.3% V5 299_300insGCA n/a
Download CSV