Transcript: Human NM_000744.6

Homo sapiens cholinergic receptor nicotinic alpha 4 subunit (CHRNA4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
CHRNA4 (1137)
Length:
5543
CDS:
232..2115

Additional Resources:

NCBI RefSeq record:
NM_000744.6
NBCI Gene record:
CHRNA4 (1137)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000744.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061105 CCCGGACATCACCTATGCCTT pLKO.1 921 CDS 100% 0.880 1.232 N CHRNA4 n/a
2 TRCN0000061103 GCTCATCGAGTCCATGCATAA pLKO.1 1341 CDS 100% 10.800 7.560 N CHRNA4 n/a
3 TRCN0000061104 GAAACTCTTCTCCGGTTACAA pLKO.1 357 CDS 100% 5.625 3.938 N CHRNA4 n/a
4 TRCN0000103023 CACCTACAACACCAGGAAGTA pLKO.1 879 CDS 100% 4.950 3.465 N Chrna4 n/a
5 TRCN0000061106 CGTGCAAATGCACATGCAAGA pLKO.1 1814 CDS 100% 4.050 2.835 N CHRNA4 n/a
6 TRCN0000061107 CAGATGATGACCACGAACGTA pLKO.1 472 CDS 100% 3.000 2.100 N CHRNA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000744.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06001 pDONR223 100% 99.5% 99.8% None (many diffs) n/a
2 ccsbBroad304_06001 pLX_304 0% 99.5% 99.8% V5 (many diffs) n/a
3 TRCN0000473092 AAAGAGAAATCGCGGGATACGCCT pLX_317 24.2% 99.5% 99.8% V5 (many diffs) n/a
Download CSV