Transcript: Human NM_000747.3

Homo sapiens cholinergic receptor nicotinic beta 1 subunit (CHRNB1), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
CHRNB1 (1140)
Length:
2560
CDS:
68..1573

Additional Resources:

NCBI RefSeq record:
NM_000747.3
NBCI Gene record:
CHRNB1 (1140)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000747.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437093 CCCTGATCTGCGGCGATTTAT pLKO_005 1306 CDS 100% 15.000 21.000 N CHRNB1 n/a
2 TRCN0000061198 CCTCACTATCAGTACCCATTA pLKO.1 969 CDS 100% 10.800 15.120 N CHRNB1 n/a
3 TRCN0000061202 GATGAGCACAAAGGTGTACTT pLKO.1 283 CDS 100% 4.950 6.930 N CHRNB1 n/a
4 TRCN0000417366 ATGCAGTATCATCTGATTTAC pLKO_005 1753 3UTR 100% 13.200 9.240 N CHRNB1 n/a
5 TRCN0000061200 CGTCTCCTCTATCAGCTACAT pLKO.1 1375 CDS 100% 4.950 3.465 N CHRNB1 n/a
6 TRCN0000061201 CCAGTGGGAGATTATCCACAA pLKO.1 685 CDS 100% 4.050 2.835 N CHRNB1 n/a
7 TRCN0000061199 GCAGAATTGCACTATGGTGTT pLKO.1 553 CDS 100% 4.050 2.835 N CHRNB1 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1905 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1906 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000747.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00308 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00308 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479543 TTCAGGGCTAATCTCCAACTCGAC pLX_317 23.5% 100% 100% V5 n/a
Download CSV