Transcript: Human NM_000748.3

Homo sapiens cholinergic receptor nicotinic beta 2 subunit (CHRNB2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CHRNB2 (1141)
Length:
5857
CDS:
268..1776

Additional Resources:

NCBI RefSeq record:
NM_000748.3
NBCI Gene record:
CHRNB2 (1141)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436092 ATGTGGTCCTGTACAACAATG pLKO_005 614 CDS 100% 10.800 15.120 N CHRNB2 n/a
2 TRCN0000447280 CAATGCCGTGGTCTCCTATGA pLKO_005 666 CDS 100% 4.950 6.930 N CHRNB2 n/a
3 TRCN0000061223 CGTGGACATCACGTATGACTT pLKO.1 930 CDS 100% 4.950 6.930 N CHRNB2 n/a
4 TRCN0000438327 TTGTACCAGCCCAGGCAATAG pLKO_005 1999 3UTR 100% 10.800 8.640 N CHRNB2 n/a
5 TRCN0000061224 CGCATGCAAGATTGAAGTAAA pLKO.1 726 CDS 100% 13.200 9.240 N CHRNB2 n/a
6 TRCN0000061225 GAGTTTGACAACATGAAGAAA pLKO.1 559 CDS 100% 5.625 3.938 N CHRNB2 n/a
7 TRCN0000061226 CTTCCTCTGGATCTTTGTCTT pLKO.1 1650 CDS 100% 4.950 3.465 N CHRNB2 n/a
8 TRCN0000437146 CTTTGGCACCATCGGCATGTT pLKO_005 1680 CDS 100% 4.950 2.970 N CHRNB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00309 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00309 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475738 TTTCACCCTCTCATCTATCGTTTA pLX_317 1.8% 100% 100% V5 n/a
Download CSV