Transcript: Human NM_000782.5

Homo sapiens cytochrome P450 family 24 subfamily A member 1 (CYP24A1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CYP24A1 (1591)
Length:
3278
CDS:
408..1952

Additional Resources:

NCBI RefSeq record:
NM_000782.5
NBCI Gene record:
CYP24A1 (1591)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000782.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308199 TTACGCCGAGTGTACCATTTA pLKO_005 1567 CDS 100% 13.200 18.480 N CYP24A1 n/a
2 TRCN0000296281 AGTAATACTGACAATCCATTT pLKO_005 2283 3UTR 100% 10.800 15.120 N CYP24A1 n/a
3 TRCN0000064342 CGAACTGAACAAATGGTCGTT pLKO.1 1022 CDS 100% 2.640 3.696 N CYP24A1 n/a
4 TRCN0000296282 TTGAGGAATATGCCGTATTTA pLKO_005 1518 CDS 100% 15.000 10.500 N CYP24A1 n/a
5 TRCN0000308200 CAATGAGGTCTTGGCCGATTT pLKO_005 944 CDS 100% 10.800 7.560 N CYP24A1 n/a
6 TRCN0000064339 CGCATGAAGTTGGGTTCCTTT pLKO.1 699 CDS 100% 4.950 3.465 N CYP24A1 n/a
7 TRCN0000064341 GCAAACAGTCTAATGTGGATT pLKO.1 1401 CDS 100% 4.950 3.465 N CYP24A1 n/a
8 TRCN0000064338 GCAGATTTCCTTTGTGACATT pLKO.1 1302 CDS 100% 4.950 3.465 N CYP24A1 n/a
9 TRCN0000289659 GCAGATTTCCTTTGTGACATT pLKO_005 1302 CDS 100% 4.950 3.465 N CYP24A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000782.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00415 pDONR223 100% 87.1% 87.1% None 1237_1434del n/a
2 ccsbBroad304_00415 pLX_304 0% 87.1% 87.1% V5 1237_1434del n/a
3 TRCN0000467921 TACCAGCGCCTATCAGGGCTACAT pLX_317 30.7% 87.1% 87.1% V5 1237_1434del n/a
Download CSV