Transcript: Human NM_000799.4

Homo sapiens erythropoietin (EPO), mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
EPO (2056)
Length:
1662
CDS:
514..1095

Additional Resources:

NCBI RefSeq record:
NM_000799.4
NBCI Gene record:
EPO (2056)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000799.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058644 CCGCAAACTCTTCCGAGTCTA pLKO.1 1008 CDS 100% 4.950 6.930 N EPO n/a
2 TRCN0000058647 CCGAGTCTACTCCAATTTCCT pLKO.1 1020 CDS 100% 3.000 4.200 N EPO n/a
3 TRCN0000058643 CCCAGACACCAAAGTTAATTT pLKO.1 717 CDS 100% 15.000 12.000 N EPO n/a
4 TRCN0000372137 AGAGCAACTCTGAGATCTAAG pLKO_005 1268 3UTR 100% 10.800 7.560 N EPO n/a
5 TRCN0000058646 GCTGAACACTGCAGCTTGAAT pLKO.1 682 CDS 100% 5.625 3.938 N EPO n/a
6 TRCN0000058645 GAACAATCACTGCTGACACTT pLKO.1 986 CDS 100% 4.950 3.465 N EPO n/a
7 TRCN0000372193 TGCAGCTGCATGTGGATAAAG pLKO_005 866 CDS 100% 13.200 7.920 N EPO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000799.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00512 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00512 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477811 TACTACCATACTGCAAGGTGTTAC pLX_317 46.3% 100% 100% V5 n/a
Download CSV