Transcript: Human NM_000826.4

Homo sapiens glutamate ionotropic receptor AMPA type subunit 2 (GRIA2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
GRIA2 (2891)
Length:
5611
CDS:
316..2967

Additional Resources:

NCBI RefSeq record:
NM_000826.4
NBCI Gene record:
GRIA2 (2891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000826.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102940 CGTGTTATGACTCCAGAATTT pLKO.1 3040 3UTR 100% 13.200 18.480 N Gria2 n/a
2 TRCN0000435950 GCAATTGCTCCATTAACTATT pLKO_005 1801 CDS 100% 13.200 18.480 N GRIA2 n/a
3 TRCN0000061685 CCCAGTAAATCTTGCAGTATT pLKO.1 2610 CDS 100% 13.200 10.560 N GRIA2 n/a
4 TRCN0000412709 GATGATTCGTTGGTATCTAAA pLKO_005 1111 CDS 100% 13.200 10.560 N GRIA2 n/a
5 TRCN0000061684 CGCCAAACATTGTGGGTTCAA pLKO.1 1674 CDS 100% 4.950 3.960 N GRIA2 n/a
6 TRCN0000412632 TTACTGATGGAGACCTATTAA pLKO_005 1040 CDS 100% 15.000 10.500 N GRIA2 n/a
7 TRCN0000061683 CCAGGTTATTACCATTGGAAA pLKO.1 978 CDS 100% 4.950 3.465 N GRIA2 n/a
8 TRCN0000061687 GCCGTTCAAGTGATGACTGAA pLKO.1 1222 CDS 100% 4.950 3.465 N GRIA2 n/a
9 TRCN0000061686 GCTATCAATGTGGGAAACATT pLKO.1 844 CDS 100% 0.563 0.394 N GRIA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000826.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15434 pDONR223 0% 85.4% 85.3% None (many diffs) n/a
2 ccsbBroad304_15434 pLX_304 0% 85.4% 85.3% V5 (many diffs) n/a
3 TRCN0000466239 GCACCCCATCATGTAGGAATTACG pLX_317 14.1% 85.4% 85.3% V5 (many diffs) n/a
Download CSV