Transcript: Human NM_000865.3

Homo sapiens 5-hydroxytryptamine receptor 1E (HTR1E), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
HTR1E (3354)
Length:
1826
CDS:
482..1579

Additional Resources:

NCBI RefSeq record:
NM_000865.3
NBCI Gene record:
HTR1E (3354)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000865.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063162 GATTCTCTATTACCGGATTTA pLKO.1 1078 CDS 100% 13.200 18.480 N HTR1E n/a
2 TRCN0000359578 AGATGCCGAGAGCATACTTAG pLKO_005 1559 CDS 100% 10.800 15.120 N HTR1E n/a
3 TRCN0000063160 CCCTTCGACAATGATCTAGAT pLKO.1 1280 CDS 100% 4.950 6.930 N HTR1E n/a
4 TRCN0000359577 ATTCTCTATTACCGGATTTAC pLKO_005 1079 CDS 100% 13.200 9.240 N HTR1E n/a
5 TRCN0000063158 CCATGTTATCTACACCATTTA pLKO.1 1015 CDS 100% 13.200 9.240 N HTR1E n/a
6 TRCN0000063159 CCCTCTGCTCTATACGAGTTT pLKO.1 1501 CDS 100% 4.950 3.465 N HTR1E n/a
7 TRCN0000063161 GTTGCTGAACTTGGCTGTGAT pLKO.1 592 CDS 100% 4.950 3.465 N HTR1E n/a
8 TRCN0000359576 ACCATGTTATCTACACCATTT pLKO_005 1014 CDS 100% 10.800 6.480 N HTR1E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000865.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489111 TTGCTCAACAGTAGGATTATGTCC pLX_317 25.8% 100% 100% V5 (not translated due to prior stop codon) n/a
2 ccsbBroadEn_06417 pDONR223 100% 99.9% 100% None 531C>T n/a
3 ccsbBroad304_06417 pLX_304 0% 99.9% 100% V5 531C>T n/a
4 TRCN0000475926 TCGCAGGTTTGCCACGAATGCCTC pLX_317 32.1% 99.9% 100% V5 531C>T n/a
Download CSV