Transcript: Human NM_000942.4

Homo sapiens peptidylprolyl isomerase B (PPIB), mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
PPIB (5479)
Length:
1045
CDS:
170..820

Additional Resources:

NCBI RefSeq record:
NM_000942.4
NBCI Gene record:
PPIB (5479)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000942.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296834 AGTCACCGTCAAGGTGTATTT pLKO_005 292 CDS 100% 13.200 18.480 N PPIB n/a
2 TRCN0000049252 GCCTTAGCTACAGGAGAGAAA pLKO.1 401 CDS 100% 4.950 6.930 N PPIB n/a
3 TRCN0000290987 GCCTTAGCTACAGGAGAGAAA pLKO_005 401 CDS 100% 4.950 6.930 N PPIB n/a
4 TRCN0000049248 CCATCGTGTAATCAAGGACTT pLKO.1 448 CDS 100% 4.050 5.670 N PPIB n/a
5 TRCN0000296764 CCTACGAATTGGAGATGAAGA pLKO_005 316 CDS 100% 4.950 3.960 N PPIB n/a
6 TRCN0000049250 CCGGGTGATCTTTGGTCTCTT pLKO.1 343 CDS 100% 4.950 3.465 N PPIB n/a
7 TRCN0000290985 CCGGGTGATCTTTGGTCTCTT pLKO_005 343 CDS 100% 4.950 3.465 N PPIB n/a
8 TRCN0000049249 CTTCGGAAAGACTGTTCCAAA pLKO.1 361 CDS 100% 4.950 3.465 N PPIB n/a
9 TRCN0000049251 GTTCTTCATCACGACAGTCAA pLKO.1 622 CDS 100% 4.950 3.465 N PPIB n/a
10 TRCN0000291057 GTTCTTCATCACGACAGTCAA pLKO_005 622 CDS 100% 4.950 3.465 N PPIB n/a
11 TRCN0000049171 GATGGCAAGCATGTGGTGTTT pLKO.1 656 CDS 100% 4.950 2.475 Y PPIA n/a
12 TRCN0000374831 CAGGAGGAAAGAGCATCTATG pLKO_005 507 CDS 100% 10.800 7.560 N Ppib n/a
13 TRCN0000454647 TCAAGGACTTCATGATCCAAG pLKO_005 459 CDS 100% 4.050 2.430 N Ppil1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000942.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489096 ACCGTTTATCGGAGCAGTGTTCTA pLX_317 45.6% 100% 100% V5 (not translated due to prior stop codon) n/a
2 ccsbBroadEn_06757 pDONR223 100% 99.8% 99.5% None 633T>A n/a
3 ccsbBroad304_06757 pLX_304 0% 99.8% 99.5% V5 633T>A n/a
4 TRCN0000474430 GAGCCTGAAAGAGTTCCCCAGTGA pLX_317 60% 99.8% 99.5% V5 633T>A n/a
Download CSV