Transcript: Human NM_001001438.2

Homo sapiens lanosterol synthase (LSS), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
LSS (4047)
Length:
2692
CDS:
80..2278

Additional Resources:

NCBI RefSeq record:
NM_001001438.2
NBCI Gene record:
LSS (4047)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001438.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045478 CCCTGCCTTCAGTCTTCTTTA pLKO.1 2395 3UTR 100% 13.200 9.240 N LSS n/a
2 TRCN0000425332 GACACCAAGAATTACTTTAAG pLKO_005 254 CDS 100% 13.200 9.240 N LSS n/a
3 TRCN0000417777 GTTCACAATTGGATCACAATG pLKO_005 2487 3UTR 100% 10.800 7.560 N LSS n/a
4 TRCN0000045482 CACGAGCTACAGGAACATCTT pLKO.1 2191 CDS 100% 4.950 3.465 N LSS n/a
5 TRCN0000045481 GCAGAAGCTGTATGAACACAT pLKO.1 1027 CDS 100% 4.950 3.465 N LSS n/a
6 TRCN0000045480 GCCGGATACAGAGAAGAGATT pLKO.1 440 CDS 100% 4.950 3.465 N LSS n/a
7 TRCN0000045479 CCGGAACATTCTTCACAAGAA pLKO.1 607 CDS 100% 4.950 2.970 N LSS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001438.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06539 pDONR223 100% 99.9% 99.8% None 864G>C;1924T>G n/a
2 ccsbBroad304_06539 pLX_304 0% 99.9% 99.8% V5 864G>C;1924T>G n/a
3 TRCN0000469759 ACGTGGAAGTGGTCTCTTTCGTCC pLX_317 19% 99.9% 99.8% V5 864G>C;1924T>G n/a
Download CSV