Transcript: Human NM_001001660.3

Homo sapiens electron transfer flavoprotein regulatory factor 1 (ETFRF1), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
ETFRF1 (144363)
Length:
1242
CDS:
139..411

Additional Resources:

NCBI RefSeq record:
NM_001001660.3
NBCI Gene record:
ETFRF1 (144363)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001660.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064535 GCTATGAAACAACGCTATTAT pLKO.1 367 CDS 100% 15.000 21.000 N ETFRF1 n/a
2 TRCN0000418931 CTTATTGCACAGGGCGAATTT pLKO_005 301 CDS 100% 13.200 18.480 N ETFRF1 n/a
3 TRCN0000414661 TAGCTATACTACCGATCATAA pLKO_005 617 3UTR 100% 13.200 18.480 N ETFRF1 n/a
4 TRCN0000064536 GCTGTATCTTGGACGAGACTA pLKO.1 192 CDS 100% 4.950 3.960 N ETFRF1 n/a
5 TRCN0000064533 CCTCTAACTTAATAGGACTTA pLKO.1 682 3UTR 100% 4.950 3.465 N ETFRF1 n/a
6 TRCN0000064537 CCTTAGGAAATACAGAGCTAT pLKO.1 351 CDS 100% 4.950 3.465 N ETFRF1 n/a
7 TRCN0000064534 GCTTTGTACTTCCTTAGGAAA pLKO.1 340 CDS 100% 4.950 3.465 N ETFRF1 n/a
8 TRCN0000241035 GAGAAGATCAAAGAACTTATC pLKO_005 286 CDS 100% 10.800 6.480 N Etfrf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001660.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13222 pDONR223 100% 97.7% 97.7% None 1_6delATGAAA n/a
2 ccsbBroad304_13222 pLX_304 0% 97.7% 97.7% V5 1_6delATGAAA n/a
3 TRCN0000466418 ACAACTCCCGTATCTCCTGCTAAG pLX_317 100% 97.7% 97.7% V5 1_6delATGAAA n/a
Download CSV