Transcript: Human NM_001001713.1

Homo sapiens SH3 domain binding glutamate rich protein (SH3BGR), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
SH3BGR (6450)
Length:
1017
CDS:
159..545

Additional Resources:

NCBI RefSeq record:
NM_001001713.1
NBCI Gene record:
SH3BGR (6450)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421554 CCAGGGTTACTGAGGACTTAT pLKO_005 663 3UTR 100% 13.200 6.600 Y SH3BGR n/a
2 TRCN0000433987 GGAAGCTATGAAGCAACATTT pLKO_005 585 3UTR 100% 13.200 6.600 Y SH3BGR n/a
3 TRCN0000424970 TAAATGTGAAGACCGTTTATG pLKO_005 737 3UTR 100% 13.200 6.600 Y SH3BGR n/a
4 TRCN0000413539 GAGGTATCTCCCGAATCATAC pLKO_005 711 3UTR 100% 10.800 5.400 Y SH3BGR n/a
5 TRCN0000127972 GAAGAAACTGCAGAAGGAGAA pLKO.1 498 CDS 100% 4.050 2.025 Y SH3BGR n/a
6 TRCN0000129450 GAGGAGGAAGAAACTGCAGAA pLKO.1 492 CDS 100% 4.050 2.025 Y SH3BGR n/a
7 TRCN0000127810 GATCTTCAATGAGGAGCAGTA pLKO.1 218 CDS 100% 4.050 2.025 Y SH3BGR n/a
8 TRCN0000129613 CTGGAGATGAAGACAACAGGA pLKO.1 133 5UTR 100% 2.640 1.320 Y SH3BGR n/a
9 TRCN0000129510 GAGAGAGAATGTTCCTGGAGA pLKO.1 161 CDS 100% 2.640 1.320 Y SH3BGR n/a
10 TRCN0000131048 CCAGATCTTCAATGAGGAGCA pLKO.1 215 CDS 100% 2.160 1.080 Y SH3BGR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06944 pDONR223 100% 53.5% 53.5% None 0_1ins333 n/a
2 ccsbBroad304_06944 pLX_304 0% 53.5% 53.5% V5 0_1ins333 n/a
Download CSV