Transcript: Human NM_001001996.2

Homo sapiens glycoprotein M6B (GPM6B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
GPM6B (2824)
Length:
5017
CDS:
456..1373

Additional Resources:

NCBI RefSeq record:
NM_001001996.2
NBCI Gene record:
GPM6B (2824)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001996.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430456 TCCGACAATACGGTATCATTC pLKO_005 1141 CDS 100% 10.800 15.120 N GPM6B n/a
2 TRCN0000063816 CCGATGCATCAGTGGAATGTT pLKO.1 962 CDS 100% 5.625 7.875 N GPM6B n/a
3 TRCN0000063815 CGGGAAGATTGCTGCACTAAA pLKO.1 1347 CDS 100% 13.200 10.560 N GPM6B n/a
4 TRCN0000434157 ATGAGATCTGGTGGCTATTTC pLKO_005 1551 3UTR 100% 13.200 9.240 N GPM6B n/a
5 TRCN0000427387 CATTAGAGAGCAGTATCTTTA pLKO_005 1647 3UTR 100% 13.200 9.240 N GPM6B n/a
6 TRCN0000091445 GTCTTCTAACTGGGCTTACTT pLKO.1 2907 3UTR 100% 5.625 3.938 N Gpm6b n/a
7 TRCN0000063814 GCCCGTGTTTATGTTCTACAA pLKO.1 1043 CDS 100% 4.950 3.465 N GPM6B n/a
8 TRCN0000063817 GTGATACAACTGATGCAGTAT pLKO.1 822 CDS 100% 4.950 3.465 N GPM6B n/a
9 TRCN0000063813 GCAGAGTCTAGGTTTCTGCAA pLKO.1 1440 3UTR 100% 0.264 0.185 N GPM6B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001996.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00668 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00668 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470278 AGTCGACGGCATAAACCGTTCCGG pLX_317 37.1% 100% 100% V5 n/a
Download CSV