Transcript: Human NM_001002.4

Homo sapiens ribosomal protein lateral stalk subunit P0 (RPLP0), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
RPLP0 (6175)
Length:
1105
CDS:
78..1031

Additional Resources:

NCBI RefSeq record:
NM_001002.4
NBCI Gene record:
RPLP0 (6175)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001002.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293172 TGATCAAGACTGGAGACAAAG pLKO_005 556 CDS 100% 10.800 6.480 N RPLP0 n/a
2 TRCN0000293173 ACCATTGAAATCCTGAGTGAT pLKO_005 528 CDS 100% 4.950 2.970 N RPLP0 n/a
3 TRCN0000293226 CCCTGAAGTGCTTGATATCAC pLKO_005 677 CDS 100% 4.950 2.970 N RPLP0 n/a
4 TRCN0000117528 GCTGCTGAACATGCTCAACAT pLKO.1 596 CDS 100% 4.950 2.970 N RPLP0 n/a
5 TRCN0000117530 GCTAAGGTTGAAGCCAAGGAA pLKO.1 963 CDS 100% 3.000 1.800 N RPLP0 n/a
6 TRCN0000286094 GCTAAGGTTGAAGCCAAGGAA pLKO_005 963 CDS 100% 3.000 1.800 N RPLP0 n/a
7 TRCN0000117529 CCATTCTATCATCAACGGGTA pLKO.1 791 CDS 100% 2.160 1.296 N RPLP0 n/a
8 TRCN0000117531 CATCCAACTATTGGATGATTA pLKO.1 128 CDS 100% 1.320 0.792 N RPLP0 n/a
9 TRCN0000117527 GCTTTAGGTATCACCACTAAA pLKO.1 495 CDS 100% 1.320 0.792 N RPLP0 n/a
10 TRCN0000286148 GCTTTAGGTATCACCACTAAA pLKO_005 495 CDS 100% 1.320 0.792 N RPLP0 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001002.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01441 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01441 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473471 GGCAACGGAACGTTATTAGGTACT pLX_317 41.1% 100% 100% V5 n/a
4 ccsbBroadEn_06887 pDONR223 100% 99.8% 100% None 144C>T n/a
5 ccsbBroad304_06887 pLX_304 0% 99.8% 100% V5 144C>T n/a
6 TRCN0000469213 GTCCTAATACCTTTCCTTACCAGA pLX_317 51.3% 99.8% 100% V5 144C>T n/a
7 ccsbBroadEn_15575 pDONR223 0% 99.8% 99.6% None 736A>G n/a
8 ccsbBroad304_15575 pLX_304 0% 99.8% 99.6% V5 736A>G n/a
9 TRCN0000471568 CGTGCTACGAGCTATTCGTACCGT pLX_317 41.1% 99.8% 99.6% V5 736A>G n/a
10 ccsbBroadEn_10284 pDONR223 100% 93.2% 87.1% None (many diffs) n/a
11 ccsbBroad304_10284 pLX_304 0% 93.2% 87.1% V5 (many diffs) n/a
12 TRCN0000479640 ACTGACATAGCGGCAACACCATGC pLX_317 41.3% 93.2% 87.1% V5 (many diffs) n/a
Download CSV