Transcript: Human NM_001002920.1

Homo sapiens POTE ankyrin domain family member A (POTEA), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-27
Taxon:
Homo sapiens (human)
Gene:
POTEA (340441)
Length:
1838
CDS:
44..1402

Additional Resources:

NCBI RefSeq record:
NM_001002920.1
NBCI Gene record:
POTEA (340441)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001002920.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157790 CGCTACAGTTCGAGTGAAGAA pLKO.1 1466 3UTR 100% 4.950 6.930 N POTEA n/a
2 TRCN0000421392 AGCGTCAGAGGATTATGATTT pLKO_005 1183 CDS 100% 13.200 9.240 N POTEA n/a
3 TRCN0000154718 GCAACTTTCCAAGGAACAGAA pLKO.1 1504 3UTR 100% 4.950 3.465 N POTEA n/a
4 TRCN0000158048 CGGAAGCAACTTTCCAAGGAA pLKO.1 1499 3UTR 100% 3.000 2.100 N POTEA n/a
5 TRCN0000156759 GCAAGAACAACATGGGTGCTT pLKO.1 159 CDS 100% 2.640 1.848 N POTEA n/a
6 TRCN0000427621 GGAGGATGAATGTGCGTTAAT pLKO_005 472 CDS 100% 13.200 7.920 N POTEA n/a
7 TRCN0000427609 TGGCAATTCAGAAGTAGTAAG pLKO_005 370 CDS 100% 10.800 6.480 N POTEA n/a
8 TRCN0000155635 CTGGACAGACAATGTCAACTT pLKO.1 398 CDS 100% 4.950 2.970 N POTEA n/a
9 TRCN0000153411 GTGGATAACCTTGATGACATA pLKO.1 1145 CDS 100% 4.950 2.970 N POTEA n/a
10 TRCN0000156988 GAAGAGTATCACAGGCCTGAA pLKO.1 1079 CDS 100% 4.050 2.430 N POTEA n/a
11 TRCN0000435530 CAATCCAGAACAAGACTTAAA pLKO_005 802 CDS 100% 13.200 6.600 Y POTEB3 n/a
12 TRCN0000147493 GCAATCCAGAACAAGACTTAA pLKO.1 801 CDS 100% 13.200 6.600 Y POTED n/a
13 TRCN0000418180 TCTGATAAAGGCCGTACAATG pLKO_005 448 CDS 100% 10.800 5.400 Y POTEB3 n/a
14 TRCN0000435921 TAACGATTCTGCTAGCCTATC pLKO_005 1261 CDS 100% 6.000 3.000 Y POTEA n/a
15 TRCN0000140286 GCTCTGATAAAGGCCGTACAA pLKO.1 446 CDS 100% 4.950 2.475 Y POTEE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001002920.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10007 pDONR223 100% 60% 51.3% None (many diffs) n/a
2 ccsbBroad304_10007 pLX_304 0% 60% 51.3% V5 (many diffs) n/a
3 TRCN0000470029 CGGTCGAATCTTAACATCGCAATG pLX_317 21.7% 60% 51.3% V5 (many diffs) n/a
Download CSV