Transcript: Human NM_001003702.2

Homo sapiens Rho guanine nucleotide exchange factor 35 (ARHGEF35), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
ARHGEF35 (445328)
Length:
2474
CDS:
174..1628

Additional Resources:

NCBI RefSeq record:
NM_001003702.2
NBCI Gene record:
ARHGEF35 (445328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001003702.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146296 CTTGAGACTTCTTTGACTGAT pLKO.1 1678 3UTR 100% 4.950 3.465 N ARHGEF35 n/a
2 TRCN0000150251 GATTTCCAATTGGATTCCCTA pLKO.1 1764 3UTR 100% 2.640 1.848 N ARHGEF35 n/a
3 TRCN0000183197 GACTTCTTTGACTGATAGATT pLKO.1 1683 3UTR 100% 5.625 3.375 N ARHGEF35 n/a
4 TRCN0000182881 CAGATGATAGAGCAGGTTAAT pLKO.1 951 CDS 100% 13.200 6.600 Y ARHGEF35 n/a
5 TRCN0000029747 GCAGAGACCAACCAGAATGAA pLKO.1 744 CDS 100% 5.625 2.813 Y ARHGEF5 n/a
6 TRCN0000147119 CAGGACTTACTTCTTTGACAT pLKO.1 634 CDS 100% 4.950 2.475 Y ARHGEF35 n/a
7 TRCN0000179458 GAAGAGGAGAATGAGCATCAT pLKO.1 1362 CDS 100% 4.950 2.475 Y ARHGEF35 n/a
8 TRCN0000180869 GCAACTCAGCAGAGTGAGTTA pLKO.1 345 CDS 100% 0.495 0.248 Y ARHGEF35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003702.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05689 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05689 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477723 TTCCTAATGGTCCGGTCATACCCC pLX_317 25.7% 100% 100% V5 n/a
Download CSV