Transcript: Mouse NM_001003717.1

Mus musculus oxysterol binding protein-like 8 (Osbpl8), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Osbpl8 (237542)
Length:
7115
CDS:
549..3092

Additional Resources:

NCBI RefSeq record:
NM_001003717.1
NBCI Gene record:
Osbpl8 (237542)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001003717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105245 GCCTATTCATTGATGTGATAT pLKO.1 4664 3UTR 100% 13.200 18.480 N Osbpl8 n/a
2 TRCN0000105247 CGTTTGAAGAAAGTCGTGAAA pLKO.1 1803 CDS 100% 4.950 6.930 N Osbpl8 n/a
3 TRCN0000105249 AGATCGAAAGACAGCACTTTA pLKO.1 1366 CDS 100% 13.200 9.240 N Osbpl8 n/a
4 TRCN0000105248 CCAAGATTTGTACTCTGATAA pLKO.1 1391 CDS 100% 13.200 9.240 N Osbpl8 n/a
5 TRCN0000105246 GCAGTCTATTTGGGCAGTGAA pLKO.1 1073 CDS 100% 4.950 3.465 N Osbpl8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04665 pDONR223 100% 85.1% 91.9% None (many diffs) n/a
2 ccsbBroad304_04665 pLX_304 0% 85.1% 91.9% V5 (many diffs) n/a
3 TRCN0000465866 CCAGCAGTGCTCGCAGGGGAAGCC pLX_317 14.7% 85.1% 91.9% V5 (many diffs) n/a
Download CSV