Transcript: Human NM_001003760.5

Homo sapiens kelch like family member 31 (KLHL31), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
KLHL31 (401265)
Length:
5776
CDS:
190..2094

Additional Resources:

NCBI RefSeq record:
NM_001003760.5
NBCI Gene record:
KLHL31 (401265)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001003760.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414107 ACGCAGGAAGAACACGTTATT pLKO_005 2113 3UTR 100% 13.200 18.480 N KLHL31 n/a
2 TRCN0000128776 CATTGCAATCTAGGCGAACAA pLKO.1 1097 CDS 100% 4.950 6.930 N KLHL31 n/a
3 TRCN0000129746 CTGAACTAACAGATGCTTCTT pLKO.1 332 CDS 100% 4.950 6.930 N KLHL31 n/a
4 TRCN0000130492 GCTATGAACTACCACTTGCTT pLKO.1 1060 CDS 100% 3.000 4.200 N KLHL31 n/a
5 TRCN0000422776 GGCTTCATGCAGTGAGTATTT pLKO_005 462 CDS 100% 13.200 10.560 N KLHL31 n/a
6 TRCN0000130427 GCACAAGACCTGGTCAATTAT pLKO.1 982 CDS 100% 15.000 10.500 N KLHL31 n/a
7 TRCN0000129889 GCATTCCAGATTGCAATGAAA pLKO.1 886 CDS 100% 5.625 3.938 N KLHL31 n/a
8 TRCN0000130283 CGTACCAAGAATGATGCAAGA pLKO.1 1011 CDS 100% 4.050 2.835 N KLHL31 n/a
9 TRCN0000130372 GCAAGAAATCAAGCCAAGCAT pLKO.1 1321 CDS 100% 3.000 2.100 N KLHL31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003760.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10129 pDONR223 100% 99.7% 99.8% None (many diffs) n/a
2 ccsbBroad304_10129 pLX_304 0% 99.7% 99.8% V5 (many diffs) n/a
3 TRCN0000477823 ACTTCTCGTCAACATCTCTATTAC pLX_317 23.7% 99.7% 99.8% V5 (many diffs) n/a
Download CSV