Transcript: Mouse NM_001003950.2

Mus musculus RAB3A interacting protein (Rab3ip), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rab3ip (216363)
Length:
2690
CDS:
152..1438

Additional Resources:

NCBI RefSeq record:
NM_001003950.2
NBCI Gene record:
Rab3ip (216363)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001003950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295669 ACGGATAGCCTGTCGCGTTTA pLKO_005 566 CDS 100% 10.800 15.120 N Rab3ip n/a
2 TRCN0000295670 TGTGATCCAGCCAATCGTAAA pLKO_005 910 CDS 100% 10.800 15.120 N Rab3ip n/a
3 TRCN0000158127 CGTTTACGAAGCCCATCTGTT pLKO.1 581 CDS 100% 4.950 6.930 N RAB3IP n/a
4 TRCN0000110107 CGTTGGCAAAGCTGGGATATT pLKO.1 1401 CDS 100% 13.200 10.560 N Rab3ip n/a
5 TRCN0000110106 GCTGATTTATCGCTGTATAAT pLKO.1 944 CDS 100% 15.000 10.500 N Rab3ip n/a
6 TRCN0000110105 CGCTCACGTTTCTGGAGAATA pLKO.1 2169 3UTR 100% 13.200 9.240 N Rab3ip n/a
7 TRCN0000306890 TAGTGAATCCCTTGATCATAA pLKO_005 1882 3UTR 100% 13.200 9.240 N Rab3ip n/a
8 TRCN0000110109 GCCCATCTGTTCTGGAAGTTA pLKO.1 591 CDS 100% 5.625 3.938 N Rab3ip n/a
9 TRCN0000288405 GCCCATCTGTTCTGGAAGTTA pLKO_005 591 CDS 100% 5.625 3.938 N Rab3ip n/a
10 TRCN0000110108 GCCTTAGATCTTTCTGATCTT pLKO.1 320 CDS 100% 0.495 0.347 N Rab3ip n/a
11 TRCN0000288340 GCCTTAGATCTTTCTGATCTT pLKO_005 320 CDS 100% 0.495 0.347 N Rab3ip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16081 pDONR223 0% 51.6% 56.3% None (many diffs) n/a
2 ccsbBroad304_16081 pLX_304 0% 51.6% 56.3% V5 (many diffs) n/a
3 TRCN0000468993 CATGCTATAGCATTGACGGAGATG pLX_317 69.1% 51.6% 56.3% V5 (many diffs) n/a
Download CSV