Transcript: Mouse NM_001004149.1

Mus musculus zinc finger protein 366 (Zfp366), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Zfp366 (238803)
Length:
2788
CDS:
57..2297

Additional Resources:

NCBI RefSeq record:
NM_001004149.1
NBCI Gene record:
Zfp366 (238803)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001004149.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176188 GCTTTCCGTAAGAACTGTCAT pLKO.1 2352 3UTR 100% 4.950 6.930 N Zfp366 n/a
2 TRCN0000215413 GAATCACATGATGAAGCATAA pLKO.1 1274 CDS 100% 10.800 7.560 N Zfp366 n/a
3 TRCN0000217319 GTATCTAAGTGAACGGCTTTA pLKO.1 2290 CDS 100% 10.800 7.560 N Zfp366 n/a
4 TRCN0000176342 CCACATGATGAACTGTGCATT pLKO.1 2517 3UTR 100% 4.950 3.465 N Zfp366 n/a
5 TRCN0000194561 CCAGTGTCATCTCTGCTACAA pLKO.1 1478 CDS 100% 4.950 3.465 N Zfp366 n/a
6 TRCN0000193093 CAACAGAATGCACAACCTGAT pLKO.1 1589 CDS 100% 4.050 2.835 N Zfp366 n/a
7 TRCN0000175501 CAGATGATCGATCTGTGCAAT pLKO.1 426 CDS 100% 0.495 0.347 N Zfp366 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004149.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09768 pDONR223 100% 83.9% 85% None (many diffs) n/a
2 ccsbBroad304_09768 pLX_304 0% 83.9% 85% V5 (many diffs) n/a
3 TRCN0000467711 CTGTCGATAAGCGCGGCATGAACC pLX_317 18.9% 83.9% 85% V5 (many diffs) n/a
Download CSV