Transcript: Mouse NM_001004180.1

Mus musculus family with sequence similarity 222, member A (Fam222a), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Fam222a (433940)
Length:
2717
CDS:
220..1581

Additional Resources:

NCBI RefSeq record:
NM_001004180.1
NBCI Gene record:
Fam222a (433940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001004180.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200159 CCAACCTACCCTCTATCCATA pLKO.1 797 CDS 100% 4.950 3.465 N Fam222a n/a
2 TRCN0000182257 GACCAGCAAGAGTGTGTGTAA pLKO.1 1395 CDS 100% 4.950 3.465 N Fam222a n/a
3 TRCN0000198426 GCATTTACAAAGCTCTGAGAA pLKO.1 2567 3UTR 100% 4.950 3.465 N Fam222a n/a
4 TRCN0000181237 CAAAGAACAGATGCTGGGTAA pLKO.1 1485 CDS 100% 4.050 2.835 N Fam222a n/a
5 TRCN0000200238 CCCTGCATCAAAGAACAGATG pLKO.1 1477 CDS 100% 4.050 2.835 N Fam222a n/a
6 TRCN0000216884 GAGTATCTCATCAACGACATC pLKO.1 1450 CDS 100% 4.050 2.835 N Fam222a n/a
7 TRCN0000182865 CCTACCCTCTATCCATAGCAT pLKO.1 801 CDS 100% 3.000 2.100 N Fam222a n/a
8 TRCN0000200215 CTTGGAACAGTGTTCTGGTGA pLKO.1 1265 CDS 100% 2.640 1.848 N Fam222a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004180.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09239 pDONR223 100% 85.1% 90.9% None (many diffs) n/a
2 ccsbBroad304_09239 pLX_304 0% 85.1% 90.9% V5 (many diffs) n/a
3 TRCN0000477989 AACAGTACCCACGGACTGATAAAA pLX_317 27.3% 85.1% 90.9% V5 (many diffs) n/a
Download CSV