Transcript: Human NM_001004464.1

Homo sapiens olfactory receptor family 10 subfamily G member 8 (OR10G8), mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
OR10G8 (219869)
Length:
936
CDS:
1..936

Additional Resources:

NCBI RefSeq record:
NM_001004464.1
NBCI Gene record:
OR10G8 (219869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004464.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204777 GTGTTTCCTCTACAGGGTCAT pLKO.1 330 CDS 100% 4.050 3.240 N OR10G8 n/a
2 TRCN0000194261 CAGCCATAGAGACTGTCATTT pLKO.1 575 CDS 100% 13.200 9.240 N OR10G8 n/a
3 TRCN0000187461 GCCCAAATTGCTGATGACTTT pLKO.1 228 CDS 100% 4.950 3.465 N OR10G8 n/a
4 TRCN0000188533 CCACACCACCATGTACTACTT pLKO.1 159 CDS 100% 4.950 2.970 N OR10G8 n/a
5 TRCN0000204638 GTCCTGATAGTGCTGTCCTAT pLKO.1 631 CDS 100% 4.950 2.475 Y OR10G7 n/a
6 TRCN0000194273 CATGTACTACTTCCTCACCAA pLKO.1 168 CDS 100% 2.640 1.320 Y OR10G7 n/a
7 TRCN0000187661 GTGGTCCTTTGCTTCTTTGTT pLKO.1 736 CDS 100% 5.625 2.813 Y OR10G4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004464.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09848 pDONR223 100% 99.8% 100% None 672C>A n/a
2 ccsbBroad304_09848 pLX_304 0% 99.8% 100% V5 672C>A n/a
3 TRCN0000480124 GCGCCAATATGCCTCCGTCAACTC pLX_317 38.8% 99.8% 100% V5 672C>A n/a
Download CSV