Transcript: Human NM_001004696.1

Homo sapiens olfactory receptor family 2 subfamily T member 4 (OR2T4), mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
OR2T4 (127074)
Length:
1047
CDS:
1..1047

Additional Resources:

NCBI RefSeq record:
NM_001004696.1
NBCI Gene record:
OR2T4 (127074)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004696.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061184 CCAAACATCCAATGGCCAATA pLKO.1 74 CDS 100% 10.800 7.560 N OR2T4 n/a
2 TRCN0000061187 CTGTTGGGACTCTTCAGACAA pLKO.1 136 CDS 100% 4.950 3.465 N OR2T4 n/a
3 TRCN0000061183 GCACTACTTTGTGTGGTCATT pLKO.1 169 CDS 100% 4.950 3.465 N OR2T4 n/a
4 TRCN0000061185 TGGCTTCACATTCACTCCCAT pLKO.1 561 CDS 100% 2.640 1.848 N OR2T4 n/a
5 TRCN0000584079 ATCTATAGTCTTAGGAATAAG pLKO_005 961 CDS 100% 13.200 6.600 Y OR2T29 n/a
6 TRCN0000584110 TGATGGTATCTGTCTTCTATA pLKO_005 911 CDS 100% 13.200 6.600 Y OR2T29 n/a
7 TRCN0000061541 CCAGGTCATGGGTGTGAATAA pLKO.1 348 CDS 100% 13.200 6.600 Y OR2T5 n/a
8 TRCN0000204421 CCAGGTCATGGGTGTGAATAA pLKO.1 348 CDS 100% 13.200 6.600 Y OR2T29 n/a
9 TRCN0000061542 ACTGTGGTCATCCTCTTCTAT pLKO.1 832 CDS 100% 5.625 2.813 Y OR2T5 n/a
10 TRCN0000188405 CTCATGGACATGGCGTACATT pLKO.1 298 CDS 100% 5.625 2.813 Y OR2T29 n/a
11 TRCN0000061186 GCTGTCCTGATCCTTCTGATA pLKO.1 223 CDS 100% 4.950 2.475 Y OR2T4 n/a
12 TRCN0000189043 GCTGTCCTGATCCTTCTGATA pLKO.1 223 CDS 100% 4.950 2.475 Y OR2T29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004696.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491891 TTTTGATCCTCTTGGCGAACTCAA pLX_317 28% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000489657 CCTTTACAGACTCCCAAACAAGAG pLX_317 37.4% 99.9% 99.7% V5 1044_1045insG n/a
Download CSV