Transcript: Human NM_001004697.2

Homo sapiens olfactory receptor family 2 subfamily T member 5 (OR2T5), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
OR2T5 (401993)
Length:
2525
CDS:
1..948

Additional Resources:

NCBI RefSeq record:
NM_001004697.2
NBCI Gene record:
OR2T5 (401993)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004697.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061540 CCACACTGGAAAGTTGGATTT pLKO.1 27 CDS 100% 10.800 6.480 N OR2T5 n/a
2 TRCN0000061539 CGATCCAAACATCCAGCTCTA pLKO.1 70 CDS 100% 4.050 2.430 N OR2T5 n/a
3 TRCN0000584602 ACACTAGCAGGTTCGGAATTT pLKO_005 328 CDS 100% 13.200 6.600 Y OR2T29 n/a
4 TRCN0000584098 ATCCTGGGAGATTCATCATTT pLKO_005 522 CDS 100% 13.200 6.600 Y OR2T29 n/a
5 TRCN0000584079 ATCTATAGTCTTAGGAATAAG pLKO_005 877 CDS 100% 13.200 6.600 Y OR2T29 n/a
6 TRCN0000584110 TGATGGTATCTGTCTTCTATA pLKO_005 827 CDS 100% 13.200 6.600 Y OR2T29 n/a
7 TRCN0000061541 CCAGGTCATGGGTGTGAATAA pLKO.1 264 CDS 100% 13.200 6.600 Y OR2T5 n/a
8 TRCN0000204421 CCAGGTCATGGGTGTGAATAA pLKO.1 264 CDS 100% 13.200 6.600 Y OR2T29 n/a
9 TRCN0000061538 CGATCATTTCAAGCTCCTATT pLKO.1 647 CDS 100% 10.800 5.400 Y OR2T5 n/a
10 TRCN0000186899 CGATCATTTCAAGCTCCTATT pLKO.1 647 CDS 100% 10.800 5.400 Y OR2T29 n/a
11 TRCN0000061542 ACTGTGGTCATCCTCTTCTAT pLKO.1 748 CDS 100% 5.625 2.813 Y OR2T5 n/a
12 TRCN0000203606 CCAAACATCCAGCTCTACTTA pLKO.1 74 CDS 100% 5.625 2.813 Y OR2T29 n/a
13 TRCN0000188405 CTCATGGACATGGCGTACATT pLKO.1 214 CDS 100% 5.625 2.813 Y OR2T29 n/a
14 TRCN0000061186 GCTGTCCTGATCCTTCTGATA pLKO.1 139 CDS 100% 4.950 2.475 Y OR2T4 n/a
15 TRCN0000189043 GCTGTCCTGATCCTTCTGATA pLKO.1 139 CDS 100% 4.950 2.475 Y OR2T29 n/a
16 TRCN0000187534 GACGATCATTTCAAGCTCCTA pLKO.1 645 CDS 100% 2.640 1.320 Y OR2T29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004697.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491891 TTTTGATCCTCTTGGCGAACTCAA pLX_317 28% 85.2% 81.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489657 CCTTTACAGACTCCCAAACAAGAG pLX_317 37.4% 85.1% 81.3% V5 (many diffs) n/a
Download CSV