Transcript: Human NM_001004704.1

Homo sapiens olfactory receptor family 4 subfamily C member 6 (OR4C6), mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
OR4C6 (219432)
Length:
930
CDS:
1..930

Additional Resources:

NCBI RefSeq record:
NM_001004704.1
NBCI Gene record:
OR4C6 (219432)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004704.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359849 CTACTTATTGTGGTAACTATT pLKO_005 121 CDS 100% 13.200 18.480 N OR4C6 n/a
2 TRCN0000359850 CACCTCACGGTGGTTGTATTG pLKO_005 721 CDS 100% 10.800 15.120 N OR4C6 n/a
3 TRCN0000359846 CATCCTGGGCCTCTTAGTTAC pLKO_005 573 CDS 100% 10.800 15.120 N OR4C6 n/a
4 TRCN0000367923 GATTTATGCACGCAATGATAC pLKO_005 449 CDS 100% 10.800 15.120 N OR4C6 n/a
5 TRCN0000359848 ACTTCTCTTCATGTATCAAAT pLKO_005 471 CDS 100% 13.200 9.240 N OR4C6 n/a
6 TRCN0000359845 GTCTGAGGTCACCTATGTATT pLKO_005 155 CDS 100% 13.200 9.240 N OR4C6 n/a
7 TRCN0000359912 TGGCCATCTTTCTTATCTTAA pLKO_005 617 CDS 100% 13.200 9.240 N OR4C6 n/a
8 TRCN0000185318 GTGTTTCTTGTCATGTATGTA pLKO.1 82 CDS 100% 5.625 3.938 N OR4C6 n/a
9 TRCN0000187373 CCTGAAGTCTTACAGCTCTAA pLKO.1 666 CDS 100% 4.950 3.465 N OR4C6 n/a
10 TRCN0000188534 CTGGATGAAATGGGAGGCTTT pLKO.1 897 CDS 100% 4.050 2.430 N OR4C6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004704.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05219 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05219 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478146 CGGCGTTAAGTTCTACATAGTTCC pLX_317 22.6% 100% 100% V5 n/a
Download CSV