Transcript: Human NM_001004724.1

Homo sapiens olfactory receptor family 4 subfamily N member 5 (OR4N5), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
OR4N5 (390437)
Length:
927
CDS:
1..927

Additional Resources:

NCBI RefSeq record:
NM_001004724.1
NBCI Gene record:
OR4N5 (390437)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004724.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188966 GCAGTCATCCTCTGTCGTATA pLKO.1 655 CDS 100% 10.800 15.120 N OR4N5 n/a
2 TRCN0000203629 CCATTGTACAAGTAGCCCTTA pLKO.1 467 CDS 100% 4.050 2.835 N OR4N5 n/a
3 TRCN0000204445 CTGAAGGAAAGAGCAAGGCTA pLKO.1 689 CDS 100% 2.640 1.848 N OR4N5 n/a
4 TRCN0000187195 CCTCTCTGAGAAGAAGGTAAT pLKO.1 255 CDS 100% 10.800 5.400 Y OR4N5 n/a
5 TRCN0000187495 GATGCATCCTACTCCTTCATT pLKO.1 208 CDS 100% 5.625 2.813 Y OR4N4 n/a
6 TRCN0000187422 CCTCTATTTCTTTCTGGGCAA pLKO.1 174 CDS 100% 2.160 1.080 Y OR4N2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004724.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09947 pDONR223 100% 83.4% 81.6% None (many diffs) n/a
2 ccsbBroad304_09947 pLX_304 0% 83.4% 81.6% V5 (many diffs) n/a
3 TRCN0000475845 ACATCCATTCGCTTTCGACAGAAA pLX_317 30.3% 83.4% 81.6% V5 (many diffs) n/a
Download CSV