Transcript: Human NM_001005281.2

Homo sapiens olfactory receptor family 6 subfamily B member 1 (OR6B1), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
OR6B1 (135946)
Length:
1047
CDS:
69..1004

Additional Resources:

NCBI RefSeq record:
NM_001005281.2
NBCI Gene record:
OR6B1 (135946)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001005281.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000584467 TGATATTCCTTGTGGCCTATA pLKO_005 154 CDS 100% 10.800 15.120 N OR6B1 n/a
2 TRCN0000584581 TCCTGTCCTACGGATGCATTC pLKO_005 712 CDS 100% 6.000 4.800 N OR6B1 n/a
3 TRCN0000584633 GTGCCCAAGTTACTGTTTAGT pLKO_005 300 CDS 100% 5.625 3.938 N OR6B1 n/a
4 TRCN0000583936 TCCACTACCCAACCATAATGA pLKO_005 457 CDS 100% 5.625 3.938 N OR6B1 n/a
5 TRCN0000583945 CACTGCACAAGCCTATGTACT pLKO_005 229 CDS 100% 4.950 3.465 N OR6B1 n/a
6 TRCN0000203665 CAAGTTCATTCTGGTGGGATT pLKO.1 98 CDS 100% 4.050 2.835 N OR6B1 n/a
7 TRCN0000359972 ACCACTTCTTCTGTGACATTT pLKO_005 592 CDS 100% 13.200 6.600 Y OR6B2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005281.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04902 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04902 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480908 CCACGTCTGATCGATGGACCGGAC pLX_317 44.3% 100% 100% V5 n/a
Download CSV