Transcript: Human NM_001005567.3

Homo sapiens olfactory receptor family 51 subfamily B member 5 (OR51B5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
OR51B5 (282763)
Length:
1454
CDS:
444..1382

Additional Resources:

NCBI RefSeq record:
NM_001005567.3
NBCI Gene record:
OR51B5 (282763)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001005567.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000583836 CATATTGTTCACCTCATTATG pLKO_005 1245 CDS 100% 13.200 18.480 N OR51B5 n/a
2 TRCN0000186169 CCTCTTAGATATACCTCTGTA pLKO.1 822 CDS 100% 4.950 6.930 N OR51B5 n/a
3 TRCN0000583931 CCACTAATGAATCCTATAACA pLKO_005 1290 CDS 100% 5.625 3.938 N OR51B5 n/a
4 TRCN0000187243 CTGTATTGTCACTCCCATGTT pLKO.1 936 CDS 100% 4.950 3.465 N OR51B5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005567.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05340 pDONR223 100% 99.8% 99.6% None 13G>A n/a
2 ccsbBroad304_05340 pLX_304 0% 99.8% 99.6% V5 13G>A n/a
3 TRCN0000477565 ATATCGAGCCGCCTATGGCATTTA pLX_317 42.1% 99.8% 99.6% V5 13G>A n/a
Download CSV