Transcript: Mouse NM_001005847.2

Mus musculus aspartylglucosaminidase (Aga), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Aga (11593)
Length:
1307
CDS:
104..1144

Additional Resources:

NCBI RefSeq record:
NM_001005847.2
NBCI Gene record:
Aga (11593)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001005847.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032281 GCAACAAACTTCCAACATTTA pLKO.1 1053 CDS 100% 13.200 18.480 N Aga n/a
2 TRCN0000032282 GCTACCAAGCTGTAGAATATA pLKO.1 909 CDS 100% 15.000 10.500 N Aga n/a
3 TRCN0000032279 GCCAGTGTGAACGGAAGTTAT pLKO.1 1022 CDS 100% 13.200 9.240 N Aga n/a
4 TRCN0000032280 GCCAGCCAAATTATTGGAGAA pLKO.1 591 CDS 100% 4.050 2.835 N Aga n/a
5 TRCN0000032283 GCCATGATAATGGATGGCACT pLKO.1 368 CDS 100% 0.216 0.151 N Aga n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005847.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05790 pDONR223 100% 84.2% 82.3% None (many diffs) n/a
2 ccsbBroad304_05790 pLX_304 0% 84.2% 82.3% V5 (many diffs) n/a
3 TRCN0000469011 ATTAGTTTCGTGTCTTGCTCTCTT pLX_317 30.8% 84.2% 82.3% V5 (many diffs) n/a
Download CSV