Transcript: Mouse NM_001008542.2

Mus musculus MAX interactor 1, dimerization protein (Mxi1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Mxi1 (17859)
Length:
5156
CDS:
195..1082

Additional Resources:

NCBI RefSeq record:
NM_001008542.2
NBCI Gene record:
Mxi1 (17859)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001008542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235818 TCGGGAGTGACGAGGGTTATT pLKO_005 1027 CDS 100% 13.200 18.480 N Mxi1 n/a
2 TRCN0000257250 GAGATGGAGCGGATACGAATG pLKO_005 849 CDS 100% 6.000 8.400 N Mxi1 n/a
3 TRCN0000173456 GAATGGACAGCATTGGATCAA pLKO.1 865 CDS 100% 4.950 3.960 N Mxi1 n/a
4 TRCN0000235817 GCAGGATAATCAGGCATTAAT pLKO_005 1493 3UTR 100% 15.000 10.500 N Mxi1 n/a
5 TRCN0000235819 CACTCGGTTTGCTCAACAAAG pLKO_005 709 CDS 100% 10.800 7.560 N Mxi1 n/a
6 TRCN0000235816 TGTGTTTAGAACGCTTGAAAG pLKO_005 649 CDS 100% 10.800 7.560 N Mxi1 n/a
7 TRCN0000193866 CAGATCTACACACAATGAGTT pLKO.1 599 CDS 100% 4.950 3.465 N Mxi1 n/a
8 TRCN0000020478 GCACACATCAAGAAACTTGAA pLKO.1 735 CDS 100% 4.950 3.465 N MXI1 n/a
9 TRCN0000194207 GCACACATCAAGAAACTTGAA pLKO.1 735 CDS 100% 4.950 3.465 N Mxi1 n/a
10 TRCN0000342878 GCACACATCAAGAAACTTGAA pLKO_005 735 CDS 100% 4.950 3.465 N MXI1 n/a
11 TRCN0000173341 GCCAACAGATCTACACACAAT pLKO.1 594 CDS 100% 4.950 3.465 N Mxi1 n/a
12 TRCN0000020477 CGAGAGGAGATTGAAGTGGAT pLKO.1 915 CDS 100% 2.640 1.848 N MXI1 n/a
13 TRCN0000173886 GCTCAACAAAGCCAAAGCACA pLKO.1 719 CDS 100% 2.640 1.848 N Mxi1 n/a
14 TRCN0000087818 GCTGGCCTCAAACTCAGATAT pLKO.1 3122 3UTR 100% 13.200 6.600 Y Cdc37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491611 CAACTGATAGAAATCAATCTATCA pLX_317 62% 73.3% 76.6% V5 (many diffs) n/a
2 ccsbBroadEn_13905 pDONR223 100% 73.2% 76.2% None (many diffs) n/a
3 ccsbBroad304_13905 pLX_304 0% 73.2% 76.2% V5 (many diffs) n/a
Download CSV