Transcript: Human NM_001008894.2

Homo sapiens NIPA magnesium transporter 2 (NIPA2), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
NIPA2 (81614)
Length:
2937
CDS:
375..1400

Additional Resources:

NCBI RefSeq record:
NM_001008894.2
NBCI Gene record:
NIPA2 (81614)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001008894.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322928 AGCTCTCAGCGTGCTAGTAAG pLKO_005 584 CDS 100% 10.800 15.120 N NIPA2 n/a
2 TRCN0000322856 GACCTCAGCACATGACGATTT pLKO_005 1587 3UTR 100% 10.800 15.120 N NIPA2 n/a
3 TRCN0000141597 CATTGCTATCAAGGAGCTGTT pLKO.1 917 CDS 100% 4.050 5.670 N NIPA2 n/a
4 TRCN0000144862 GATATTCTTGTTGCATGCCTT pLKO.1 1193 CDS 100% 2.640 3.696 N NIPA2 n/a
5 TRCN0000139930 GCAAGATATGCCTGTTGACGA pLKO.1 1130 CDS 100% 2.640 3.696 N NIPA2 n/a
6 TRCN0000322858 GACGATGTCATTGGTACTTTG pLKO_005 1146 CDS 100% 10.800 7.560 N NIPA2 n/a
7 TRCN0000142069 GTCTCCCGAAGAAATGGAAAT pLKO.1 1365 CDS 100% 10.800 7.560 N NIPA2 n/a
8 TRCN0000124441 GCACACAGATTAATTACCTAA pLKO.1 1006 CDS 100% 4.950 3.465 N Nipa2 n/a
9 TRCN0000142546 GCCTTTAAAGACGTCAGCTTT pLKO.1 1209 CDS 100% 4.950 3.465 N NIPA2 n/a
10 TRCN0000144913 GAGAAAGCAATGAATGGCAAT pLKO.1 1266 CDS 100% 4.050 2.835 N NIPA2 n/a
11 TRCN0000140273 GCTATCAAGGAGCTGTTTGCA pLKO.1 921 CDS 100% 3.000 2.100 N NIPA2 n/a
12 TRCN0000142314 GTCATTCATGCTCCAAAGGAA pLKO.1 696 CDS 100% 3.000 2.100 N NIPA2 n/a
13 TRCN0000322926 GTCATTCATGCTCCAAAGGAA pLKO_005 696 CDS 100% 3.000 2.100 N NIPA2 n/a
14 TRCN0000141224 CGAGAAAGCAATGAATGGCAA pLKO.1 1265 CDS 100% 2.640 1.848 N NIPA2 n/a
15 TRCN0000322927 CGAGAAAGCAATGAATGGCAA pLKO_005 1265 CDS 100% 2.640 1.848 N NIPA2 n/a
16 TRCN0000144689 GAAATGGAAATCTGACAGCTT pLKO.1 1375 CDS 100% 2.640 1.584 N NIPA2 n/a
17 TRCN0000124443 CAGACAAACATTCTTGTGTAT pLKO.1 840 CDS 100% 4.950 3.465 N Nipa2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008894.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09075 pDONR223 100% 94.5% 94.1% None 6C>T;139_140ins57;850A>G n/a
2 ccsbBroad304_09075 pLX_304 0% 94.5% 94.1% V5 6C>T;139_140ins57;850A>G n/a
3 TRCN0000469676 GGTGTGATTTCAGTCACTTCGGTG pLX_317 41.7% 94.5% 94.1% V5 6C>T;139_140ins57;850A>G n/a
Download CSV