Transcript: Human NM_001011537.2

Homo sapiens forty-two-three domain containing 1 (FYTTD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
FYTTD1 (84248)
Length:
3654
CDS:
239..1117

Additional Resources:

NCBI RefSeq record:
NM_001011537.2
NBCI Gene record:
FYTTD1 (84248)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001011537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148321 CAATGCCCAGTAACTCAGAAA pLKO.1 881 CDS 100% 4.950 6.930 N FYTTD1 n/a
2 TRCN0000146532 GCCCAGTTGAATACAGAACAA pLKO.1 761 CDS 100% 4.950 6.930 N FYTTD1 n/a
3 TRCN0000102599 CCTATGAATCGTCCACCTCTA pLKO.1 515 CDS 100% 4.050 5.670 N Fyttd1 n/a
4 TRCN0000147729 GAATCGTAGAGGAAGAGTAAT pLKO.1 415 CDS 100% 13.200 10.560 N FYTTD1 n/a
5 TRCN0000422633 TAGACTTTGTCATGGTAAATC pLKO_005 1469 3UTR 100% 13.200 9.240 N FYTTD1 n/a
6 TRCN0000434278 AGCAAAGAGAACTCGTCAATG pLKO_005 799 CDS 100% 10.800 7.560 N FYTTD1 n/a
7 TRCN0000148243 GTAACTCAGAAACCACGATTA pLKO.1 890 CDS 100% 10.800 7.560 N FYTTD1 n/a
8 TRCN0000149093 GTTGAATCGAAAGGAAGGGAA pLKO.1 277 CDS 100% 2.640 1.848 N FYTTD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09162 pDONR223 100% 90.2% 88.1% None (many diffs) n/a
2 ccsbBroad304_09162 pLX_304 0% 90.2% 88.1% V5 (many diffs) n/a
3 TRCN0000473780 CGGCTGGCTCGACCGTGGAGCATT pLX_317 54.9% 90.2% 88.1% V5 (many diffs) n/a
Download CSV