Transcript: Human NM_001012414.3

Homo sapiens tripartite motif containing 61 (TRIM61), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
TRIM61 (391712)
Length:
1571
CDS:
603..1232

Additional Resources:

NCBI RefSeq record:
NM_001012414.3
NBCI Gene record:
TRIM61 (391712)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001012414.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162260 CCATGTGTAGGGTATGTATAT pLKO.1 1342 3UTR 100% 13.200 18.480 N TRIM61 n/a
2 TRCN0000162324 CATAACTATGCAAACCAGGAA pLKO.1 1085 CDS 100% 2.640 1.848 N TRIM61 n/a
3 TRCN0000164487 CCTGGAAGGATCTACATGATA pLKO.1 730 CDS 100% 5.625 3.375 N TRIM61 n/a
4 TRCN0000165687 CCAGGAAATCACTGGAACTGA pLKO.1 1099 CDS 100% 3.000 1.800 N TRIM61 n/a
5 TRCN0000163543 GCTGGGTAGTTTGACTGAAAT pLKO.1 812 CDS 100% 13.200 6.600 Y TRIM61 n/a
6 TRCN0000161491 GCATGTGTGTAAGAAGCATAA pLKO.1 884 CDS 100% 10.800 5.400 Y TRIM61 n/a
7 TRCN0000166802 CTTCTGTCTCTCCTGCATCAT pLKO.1 704 CDS 100% 4.950 2.475 Y TRIM61 n/a
8 TRCN0000159764 GTAAGAAGCATAATCAGGTTT pLKO.1 892 CDS 100% 4.950 2.475 Y TRIM61 n/a
9 TRCN0000164273 CTGCATCATTATGTCCTGGAA pLKO.1 716 CDS 100% 2.640 1.320 Y TRIM61 n/a
10 TRCN0000166456 CTGGACTACTTGAAAGACCCA pLKO.1 660 CDS 100% 0.660 0.330 Y TRIM61 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012414.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05623 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05623 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476965 CCCGGAAATAATAATTTCCCTTGC pLX_317 2.6% 100% 100% V5 n/a
4 ccsbBroadEn_10792 pDONR223 100% 11.6% 12.8% None (many diffs) n/a
5 ccsbBroad304_10792 pLX_304 0% 11.6% 12.8% V5 (many diffs) n/a
6 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 11.6% 12.8% V5 (many diffs) n/a
Download CSV