Transcript: Mouse NM_001013577.1

Mus musculus INTS3 and NABP interacting protein (Inip), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Inip (66209)
Length:
3221
CDS:
185..499

Additional Resources:

NCBI RefSeq record:
NM_001013577.1
NBCI Gene record:
Inip (66209)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001013577.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217769 GAGCGTCTACCTCAGTTAATA pLKO.1 2317 3UTR 100% 15.000 10.500 N Inip n/a
2 TRCN0000269142 GGCTTAGGGAGTCCTATAATA pLKO_005 1503 3UTR 100% 15.000 10.500 N Inip n/a
3 TRCN0000269090 CTGCCTTTGGGAATCTGATTC pLKO_005 447 CDS 100% 10.800 7.560 N Inip n/a
4 TRCN0000283898 ACTTATGCAGAACCAATCTTC pLKO_005 271 CDS 100% 4.950 3.465 N Inip n/a
5 TRCN0000283899 TCCAGACCCTCTCTTACCAAG pLKO_005 323 CDS 100% 4.050 2.835 N Inip n/a
6 TRCN0000192361 CATAACTCAAGACTCTGCCTT pLKO.1 433 CDS 100% 2.640 1.848 N Inip n/a
7 TRCN0000189535 CAATCTTCAACAAGCCACCCT pLKO.1 284 CDS 100% 0.660 0.462 N Inip n/a
8 TRCN0000269143 ATTCCTCTGGCTACTTCATAA pLKO_005 417 CDS 100% 13.200 7.920 N Inip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013577.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03862 pDONR223 100% 90.3% 96.1% None (many diffs) n/a
2 ccsbBroad304_03862 pLX_304 0% 90.3% 96.1% V5 (many diffs) n/a
3 TRCN0000465608 CTACAAAATTAGTCGAGAGTACAG pLX_317 100% 90.3% 96.1% V5 (many diffs) n/a
Download CSV