Transcript: Mouse NM_001013756.1

Mus musculus grainyhead-like 3 (Drosophila) (Grhl3), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Grhl3 (230824)
Length:
2798
CDS:
197..2008

Additional Resources:

NCBI RefSeq record:
NM_001013756.1
NBCI Gene record:
Grhl3 (230824)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001013756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103546 GCCTCAAGAGTGACTTTGAAT pLKO.1 873 CDS 100% 5.625 3.938 N Grhl3 n/a
2 TRCN0000103549 CCAGAAGTTTCCCTACAGTAA pLKO.1 256 CDS 100% 4.950 3.465 N Grhl3 n/a
3 TRCN0000103548 CCTGGTTAACATGGACAACAA pLKO.1 1897 CDS 100% 4.950 3.465 N Grhl3 n/a
4 TRCN0000103547 CGACTACTATATGGGTCCCAA pLKO.1 388 CDS 100% 2.640 1.848 N Grhl3 n/a
5 TRCN0000103545 GCACAAGATGTAAGTCACCAT pLKO.1 2498 3UTR 100% 2.640 1.848 N Grhl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10212 pDONR223 100% 80.3% 84.2% None (many diffs) n/a
2 ccsbBroad304_10212 pLX_304 0% 80.3% 84.2% V5 (many diffs) n/a
3 TRCN0000466452 CGTTCTAAGCAATTTTCCATACAT pLX_317 16.7% 80.3% 84.2% V5 (many diffs) n/a
Download CSV