Transcript: Mouse NM_001013814.1

Mus musculus aminomethyltransferase (Amt), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Amt (434437)
Length:
1325
CDS:
15..1226

Additional Resources:

NCBI RefSeq record:
NM_001013814.1
NBCI Gene record:
Amt (434437)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001013814.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097364 GCGATGGGTTATGTGCCATTT pLKO.1 1095 CDS 100% 10.800 15.120 N Amt n/a
2 TRCN0000097367 CCAGGGAACACTCTCTTTGTT pLKO.1 350 CDS 100% 5.625 3.938 N Amt n/a
3 TRCN0000097365 CACCTGTATGTAGTATCCAAT pLKO.1 429 CDS 100% 4.950 3.465 N Amt n/a
4 TRCN0000097368 CTTGGCAACTACTCTGTTGAA pLKO.1 740 CDS 100% 4.950 3.465 N Amt n/a
5 TRCN0000097366 CCACTCTATGACTTCCACCTA pLKO.1 123 CDS 100% 2.640 1.848 N Amt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013814.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10676 pDONR223 100% 60.4% 62.7% None (many diffs) n/a
2 ccsbBroad304_10676 pLX_304 0% 60.4% 62.7% V5 (many diffs) n/a
3 TRCN0000467128 AAGAATATGTGGTAGTGCTTGATG pLX_317 48.1% 60.4% 62.7% V5 (many diffs) n/a
Download CSV