Transcript: Mouse NM_001013826.2

Mus musculus dual specificity phosphatase and pro isomerase domain containing 1 (Dupd1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Dupd1 (435391)
Length:
1103
CDS:
97..744

Additional Resources:

NCBI RefSeq record:
NM_001013826.2
NBCI Gene record:
Dupd1 (435391)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001013826.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081356 CCTGATGATCCACAAGAACAT pLKO.1 576 CDS 100% 4.950 3.465 N Dupd1 n/a
2 TRCN0000363283 GGCCTACCTGATGATCCACAA pLKO_005 570 CDS 100% 4.050 2.835 N DUPD1 n/a
3 TRCN0000049124 GACCACAGTAAGATCCTGGTT pLKO.1 508 CDS 100% 2.640 1.848 N DUPD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013826.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05440 pDONR223 100% 83.7% 82.2% None (many diffs) n/a
2 ccsbBroad304_05440 pLX_304 0% 83.7% 82.2% V5 (many diffs) n/a
3 TRCN0000481583 AAACACTGTCCTCACTCACAGCGC pLX_317 73% 83.7% 82.2% V5 (many diffs) n/a
Download CSV