Transcript: Human NM_001014794.3

Homo sapiens integrin linked kinase (ILK), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
ILK (3611)
Length:
1713
CDS:
96..1454

Additional Resources:

NCBI RefSeq record:
NM_001014794.3
NBCI Gene record:
ILK (3611)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146314 ACATTGTAGAGGGATCCATA pXPR_003 CGG 822 60% 9 1.7313 ILK ILK 75910
2 BRDN0001147357 GATCAATGTAATGAACCGTG pXPR_003 GGG 193 14% 3 0.8057 ILK ILK 75909
3 BRDN0001144869 CGGAGAACGACCTCAACCAG pXPR_003 GGG 84 6% 2 0.4037 ILK ILK 75911
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001014794.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000969 CCGAAATGGAACCCTGAACAA pLKO.1 626 CDS 100% 4.950 6.930 N ILK n/a
2 TRCN0000195112 CCGTAGTGTAATGATTGATGA pLKO.1 1061 CDS 100% 4.950 6.930 N ILK n/a
3 TRCN0000279846 CCGTAGTGTAATGATTGATGA pLKO_005 1061 CDS 100% 4.950 6.930 N ILK n/a
4 TRCN0000199863 GCACTCAATAGCCGTAGTGTA pLKO.1 1050 CDS 100% 4.950 6.930 N ILK n/a
5 TRCN0000199983 GCAATGACATTGTCGTGAAGG pLKO.1 736 CDS 100% 4.050 5.670 N ILK n/a
6 TRCN0000279845 GCAATGACATTGTCGTGAAGG pLKO_005 736 CDS 100% 4.050 5.670 N ILK n/a
7 TRCN0000194750 CGACCCAAATTTGACATGATT pLKO.1 1401 CDS 100% 5.625 4.500 N ILK n/a
8 TRCN0000279778 CGACCCAAATTTGACATGATT pLKO_005 1401 CDS 100% 5.625 4.500 N ILK n/a
9 TRCN0000000972 TCCCACGACATGCACTCAATA pLKO.1 1039 CDS 100% 13.200 9.240 N ILK n/a
10 TRCN0000000970 GCAGTACAAGGCAGACATCAA pLKO.1 356 CDS 100% 4.950 3.465 N ILK n/a
11 TRCN0000297330 GCAGTACAAGGCAGACATCAA pLKO_005 356 CDS 100% 4.950 3.465 N ILK n/a
12 TRCN0000000971 CTGAACAAACACTCTGGCATT pLKO.1 639 CDS 100% 4.050 2.835 N ILK n/a
13 TRCN0000000968 TCAGAGCTTTGTCACTTGCCA pLKO.1 1630 3UTR 100% 0.750 0.525 N ILK n/a
14 TRCN0000279854 TCAGAGCTTTGTCACTTGCCA pLKO_005 1630 3UTR 100% 0.750 0.525 N ILK n/a
15 TRCN0000199581 GACTGGAAGGTCCTTGCCTGA pLKO.1 1455 CDS 100% 0.720 0.504 N ILK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001014794.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06450 pDONR223 100% 99.8% 100% None 297C>T;819G>A n/a
2 ccsbBroad304_06450 pLX_304 0% 99.8% 100% V5 297C>T;819G>A n/a
3 TRCN0000474279 GTTTGCGACGCCATTAAGAACTAA pLX_317 38.9% 99.8% 100% V5 297C>T;819G>A n/a
4 ccsbBroadEn_14673 pDONR223 0% 99.8% 100% None 297C>T;819G>A n/a
5 ccsbBroad304_14673 pLX_304 0% 99.8% 100% V5 297C>T;819G>A n/a
6 TRCN0000472662 TCTACCGGATGAGTACTTCCCATG pLX_317 32.7% 99.8% 100% V5 297C>T;819G>A n/a
7 TRCN0000488717 AAGCACACCTCCCTACCAGTGAGA pLX_317 29% 99.8% 100% V5 (not translated due to prior stop codon) 297C>T;819G>A n/a
Download CSV