Transcript: Human NM_001020.6

Homo sapiens ribosomal protein S16 (RPS16), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RPS16 (6217)
Length:
631
CDS:
55..495

Additional Resources:

NCBI RefSeq record:
NM_001020.6
NBCI Gene record:
RPS16 (6217)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001020.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010941 GCGCACGCTACAGTACAAGCT pLKO.1 186 CDS 100% 0.880 1.232 N RPS16 n/a
2 TRCN0000005474 GCTACAGTACAAGCTGCTGGA pLKO.1 192 CDS 100% 2.160 1.512 N RPS16 n/a
3 TRCN0000005472 CGTGGCCCAGATTTATGCTAT pLKO.1 285 CDS 100% 4.950 2.970 N RPS16 n/a
4 TRCN0000104186 GCAGGTCTTCGGACGCAAGAA pLKO.1 84 CDS 100% 1.650 0.990 N Rps16 n/a
5 TRCN0000005473 GTGGCCTATTACCAGAAATAT pLKO.1 331 CDS 100% 15.000 7.500 Y RPS16 n/a
6 TRCN0000005471 GCTTCCAAGAAGGAGATCAAA pLKO.1 361 CDS 100% 5.625 2.813 Y RPS16 n/a
7 TRCN0000104189 TCCAAGAAGGAGATCAAAGAT pLKO.1 364 CDS 100% 5.625 2.813 Y Rps16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001020.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01455 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01455 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472435 GGACCGTGTACATGATTACCGCAA pLX_317 90.6% 100% 100% V5 n/a
4 ccsbBroadEn_15581 pDONR223 0% 99.7% 100% None 402C>T n/a
5 ccsbBroad304_15581 pLX_304 0% 99.7% 100% V5 402C>T n/a
6 ccsbBroadEn_11110 pDONR223 100% 67.3% 56.6% None (many diffs) n/a
7 ccsbBroad304_11110 pLX_304 0% 67.3% 56.6% V5 (many diffs) n/a
8 TRCN0000470408 GGGGCCCAAATCAATACGGCCTAT pLX_317 90.9% 67.3% 56.6% V5 (many diffs) n/a
Download CSV