Transcript: Mouse NM_001024139.1

Mus musculus a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 15 (Adamts15), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Adamts15 (235130)
Length:
5946
CDS:
216..3068

Additional Resources:

NCBI RefSeq record:
NM_001024139.1
NBCI Gene record:
Adamts15 (235130)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001024139.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031581 GCGGATTTGGAACATTATCTA pLKO.1 921 CDS 100% 5.625 4.500 N Adamts15 n/a
2 TRCN0000031579 CGAGGGAGTAAGAGTGAAATA pLKO.1 1880 CDS 100% 13.200 9.240 N Adamts15 n/a
3 TRCN0000031583 GCTGAACAAAGTGAGCGATAA pLKO.1 1109 CDS 100% 10.800 7.560 N Adamts15 n/a
4 TRCN0000031580 CGCTGCCATTATTACTGACTT pLKO.1 1436 CDS 100% 4.950 3.465 N Adamts15 n/a
5 TRCN0000031582 CCAAGGCAAATACCTGCTCAA pLKO.1 2408 CDS 100% 4.050 2.835 N Adamts15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024139.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05159 pDONR223 100% 87.9% 93% None (many diffs) n/a
2 ccsbBroad304_05159 pLX_304 0% 87.9% 93% V5 (many diffs) n/a
3 TRCN0000467885 CTCGTCCTAAACGAACAAAACCCT pLX_317 14.1% 87.9% 93% V5 (many diffs) n/a
Download CSV