Transcript: Mouse NM_001029868.2

Mus musculus PDZ domain containing 4 (Pdzd4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Pdzd4 (245469)
Length:
3991
CDS:
629..2947

Additional Resources:

NCBI RefSeq record:
NM_001029868.2
NBCI Gene record:
Pdzd4 (245469)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001029868.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099136 GCATCTACGTTGGAGAGGTAA pLKO.1 1116 CDS 100% 4.950 6.930 N Pdzd4 n/a
2 TRCN0000099138 CTAGAGTTCAAGTGCCGCAAT pLKO.1 1868 CDS 100% 4.050 5.670 N Pdzd4 n/a
3 TRCN0000099137 CCTTCGTGCTAGGAAGCTAAA pLKO.1 1369 CDS 100% 10.800 8.640 N Pdzd4 n/a
4 TRCN0000099135 GCTGCAATTATTTGTAGACAA pLKO.1 3327 3UTR 100% 4.950 3.465 N Pdzd4 n/a
5 TRCN0000099139 GAGCAGTACAAAGTGATGCTT pLKO.1 665 CDS 100% 3.000 2.100 N Pdzd4 n/a
6 TRCN0000161219 GAGGTAAATCCCAACAGCATT pLKO.1 1130 CDS 100% 4.950 2.970 N PDZD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001029868.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12372 pDONR223 100% 86.5% 93% None (many diffs) n/a
2 ccsbBroad304_12372 pLX_304 0% 86.5% 93% V5 (many diffs) n/a
3 TRCN0000469818 AAGTAATACTGAATAGACTAACGC pLX_317 21.2% 86.5% 93% V5 (many diffs) n/a
Download CSV