Transcript: Human NM_001029997.4

Homo sapiens zinc finger protein 181 (ZNF181), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
ZNF181 (339318)
Length:
5792
CDS:
796..2511

Additional Resources:

NCBI RefSeq record:
NM_001029997.4
NBCI Gene record:
ZNF181 (339318)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001029997.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147070 CCTGAAGGATTTAGGAGTTAT pLKO.1 2994 3UTR 100% 13.200 7.920 N ZNF181 n/a
2 TRCN0000150266 GCAGTGGTTATCATGGTAAAT pLKO.1 2513 3UTR 100% 13.200 7.920 N ZNF181 n/a
3 TRCN0000147098 CCAGCTTGAATCACTGAATAT pLKO.1 2124 CDS 100% 13.200 6.600 Y ZNF181 n/a
4 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 2246 CDS 100% 5.625 2.813 Y ZNF345 n/a
5 TRCN0000015520 CTGGAGAGAAGCCTTATGAAT pLKO.1 1910 CDS 100% 5.625 2.813 Y ZNF625 n/a
6 TRCN0000147181 CCAGACTTGTAATAGAGAGAA pLKO.1 1479 CDS 100% 4.950 2.475 Y ZNF181 n/a
7 TRCN0000149621 GCTTGCAGTTTCAGTTGAGTT pLKO.1 3107 3UTR 100% 4.950 2.475 Y ZNF181 n/a
8 TRCN0000012945 GCAGTGAATGTGGGAAAGCTT pLKO.1 1511 CDS 100% 3.000 1.500 Y ZNF146 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001029997.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05456 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05456 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476796 GTTAAAAAAATTTTAGATTTCCGT pLX_317 17.5% 100% 100% V5 n/a
4 ccsbBroadEn_03678 pDONR223 100% 66.7% 63.2% None (many diffs) n/a
5 ccsbBroad304_03678 pLX_304 0% 66.7% 63.2% V5 (many diffs) n/a
6 TRCN0000465358 CTTACTCGAGAAGCCTAGGAGATG pLX_317 26.9% 66.7% 63.2% V5 (many diffs) n/a
Download CSV