Transcript: Mouse NM_001031814.1

Mus musculus SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) (Smg1), mRNA.

Source:
NCBI, updated 2017-04-16
Taxon:
Mus musculus (mouse)
Gene:
Smg1 (233789)
Length:
15553
CDS:
348..11324

Additional Resources:

NCBI RefSeq record:
NM_001031814.1
NBCI Gene record:
Smg1 (233789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001031814.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362992 CGAGTTAGAGCTTCGTTTATT pLKO_005 10382 CDS 100% 15.000 21.000 N Smg1 n/a
2 TRCN0000244938 GAGTTAGAGCTTCGTTTATTA pLKO_005 10383 CDS 100% 15.000 21.000 N SMG1 n/a
3 TRCN0000088687 GCTGAGTAAGAATCTGATGAT pLKO.1 2264 CDS 100% 4.950 6.930 N Smg1 n/a
4 TRCN0000088685 CGGCAAATCATATTCCCAGAA pLKO.1 8925 CDS 100% 4.050 5.670 N Smg1 n/a
5 TRCN0000363467 ATGCAACTGAAGGTGTTATTA pLKO_005 5512 CDS 100% 15.000 10.500 N Smg1 n/a
6 TRCN0000244939 ATGCCTCCTGATGGATATAAT pLKO_005 15358 3UTR 100% 15.000 10.500 N SMG1 n/a
7 TRCN0000378443 CTCGTTGCTACCCTCATATTT pLKO_005 1252 CDS 100% 15.000 10.500 N Smg1 n/a
8 TRCN0000363068 ATGTTATCTGGCGGCAGTTAA pLKO_005 5455 CDS 100% 13.200 9.240 N Smg1 n/a
9 TRCN0000037410 GCCATGACTAACACTGAAATT pLKO.1 6642 CDS 100% 13.200 9.240 N SMG1 n/a
10 TRCN0000088683 CCCTTGAGAATTGAAATGTAT pLKO.1 13853 3UTR 100% 5.625 3.938 N Smg1 n/a
11 TRCN0000088684 CCTCATATTATATCCTGCAAT pLKO.1 5903 CDS 100% 4.950 3.465 N Smg1 n/a
12 TRCN0000088686 GCAGCTTAGATGAATACCTAA pLKO.1 7810 CDS 100% 4.950 3.465 N Smg1 n/a
13 TRCN0000082411 GCCACCAAAGACATGAGGAAA pLKO.1 726 CDS 100% 4.950 2.970 N NPIPB4 n/a
14 TRCN0000183297 GCTTGAAGAATATTCCTGTTT pLKO.1 2002 CDS 100% 4.950 3.465 N BOLA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001031814.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488255 ACGTTGGAAAGGGAAAGCTGGCTT pLX_317 1.7% 90.4% 97.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_10398 pDONR223 100% 4.1% 4.1% None (many diffs) n/a
3 ccsbBroad304_10398 pLX_304 0% 4.1% 4.1% V5 (many diffs) n/a
4 TRCN0000474199 GATTATACATTTATGTAATCCGTA pLX_317 93.9% 4.1% 4.1% V5 (many diffs) n/a
Download CSV