Transcript: Human NM_001031847.2

Homo sapiens carnitine palmitoyltransferase 1A (CPT1A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
CPT1A (1374)
Length:
2671
CDS:
171..2441

Additional Resources:

NCBI RefSeq record:
NM_001031847.2
NBCI Gene record:
CPT1A (1374)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001031847.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036283 GACAACGATGTACGCCAAGAT pLKO.1 380 CDS 100% 4.950 6.930 N CPT1A n/a
2 TRCN0000036280 GCGTTCTTCGTGACGTTAGAT pLKO.1 1413 CDS 100% 5.625 7.313 N CPT1A n/a
3 TRCN0000036282 CGATGTTACGACAGGTGGTTT pLKO.1 1509 CDS 100% 4.950 3.465 N CPT1A n/a
4 TRCN0000036281 CGTAGCCTTTGGTAAAGGAAT pLKO.1 1823 CDS 100% 4.950 3.465 N CPT1A n/a
5 TRCN0000036279 GCCATGAAGCTCTTAGACAAA pLKO.1 241 CDS 100% 4.950 3.465 N CPT1A n/a
6 TRCN0000110548 GCAACTATTATGCCATGGATT pLKO.1 925 CDS 100% 4.950 2.970 N Cpt1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001031847.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00359 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00359 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466447 ATGTGTTTGCCGCACGCTGACCGC pLX_317 19% 100% 100% V5 n/a
Download CSV