Transcript: Human NM_001032387.2

Homo sapiens sulfite oxidase (SUOX), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SUOX (6821)
Length:
2210
CDS:
75..1712

Additional Resources:

NCBI RefSeq record:
NM_001032387.2
NBCI Gene record:
SUOX (6821)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001032387.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245112 AGTCCCATGTGCGTGAGTTAC pLKO_005 508 CDS 100% 10.800 15.120 N SUOX n/a
2 TRCN0000245114 GGCATCGTGTCCATGTCTATG pLKO_005 1681 CDS 100% 10.800 15.120 N SUOX n/a
3 TRCN0000046262 TCAGGAGTCAACACACATATA pLKO.1 308 CDS 100% 13.200 10.560 N SUOX n/a
4 TRCN0000245115 GCCATACCCAAGTACACATAT pLKO_005 1821 3UTR 100% 13.200 9.240 N SUOX n/a
5 TRCN0000245113 CACGGCTCTGTGATGTGTTAG pLKO_005 961 CDS 100% 10.800 7.560 N SUOX n/a
6 TRCN0000370036 CTTCCCTCTTTGGACACTATG pLKO_005 1862 3UTR 100% 10.800 7.560 N SUOX n/a
7 TRCN0000377440 GCCTGCAGACTCAAGTCAATC pLKO_005 117 CDS 100% 10.800 7.560 N SUOX n/a
8 TRCN0000377389 ATCCAGACACCTATCGCTTAC pLKO_005 751 CDS 100% 6.000 4.200 N SUOX n/a
9 TRCN0000046259 ACAGAATTTGTGGACCTACAT pLKO.1 408 CDS 100% 4.950 3.465 N SUOX n/a
10 TRCN0000046258 CCTGGATGACTTGCACAACTT pLKO.1 812 CDS 100% 4.950 3.465 N SUOX n/a
11 TRCN0000300408 CCTGGATGACTTGCACAACTT pLKO_005 812 CDS 100% 4.950 3.465 N SUOX n/a
12 TRCN0000046260 CCATCCATTCAGGAACTTCCT pLKO.1 1326 CDS 100% 2.640 1.848 N SUOX n/a
13 TRCN0000046261 CTCTGAGATGACTCAGGTCAA pLKO.1 881 CDS 100% 0.405 0.284 N SUOX n/a
14 TRCN0000377388 CCAGGAAGTGTGAGCTGTTAC pLKO_005 1914 3UTR 100% 10.800 6.480 N SUOX n/a
15 TRCN0000370080 CTGTGGATGATGGTTACAATG pLKO_005 1603 CDS 100% 10.800 6.480 N SUOX n/a
16 TRCN0000245111 TTCAGGCCTGCTCCACAAATG pLKO_005 154 CDS 100% 10.800 6.480 N SUOX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001032387.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07017 pDONR223 100% 99.9% 100% None 1281G>C n/a
2 ccsbBroad304_07017 pLX_304 0% 99.9% 100% V5 1281G>C n/a
3 TRCN0000477856 TCTCAGTCTCCACTCGTCTTGAGA pLX_317 15.3% 99.9% 100% V5 1281G>C n/a
Download CSV