Transcript: Mouse NM_001033158.2

Mus musculus RAS-like, family 12 (Rasl12), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rasl12 (70784)
Length:
2430
CDS:
78..878

Additional Resources:

NCBI RefSeq record:
NM_001033158.2
NBCI Gene record:
Rasl12 (70784)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033158.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193687 CCAAGAGGTTTATCAGCGAAT pLKO.1 202 CDS 100% 4.050 5.670 N Rasl12 n/a
2 TRCN0000193508 GTACTTTCAACACTCTCTCTA pLKO.1 733 CDS 100% 4.950 3.465 N Rasl12 n/a
3 TRCN0000173998 CCTGGAAGTTAACCTGGCTAT pLKO.1 131 CDS 100% 4.050 2.835 N Rasl12 n/a
4 TRCN0000194033 GTCACTGTGAAATCATCTCGT pLKO.1 798 CDS 100% 2.640 1.848 N Rasl12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033158.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08272 pDONR223 100% 88.5% 93.6% None (many diffs) n/a
2 ccsbBroad304_08272 pLX_304 0% 88.5% 93.6% V5 (many diffs) n/a
3 TRCN0000470447 AATGCACCAAATTCCTAAGTCAGC pLX_317 55.9% 88.5% 93.6% V5 (many diffs) n/a
Download CSV