Transcript: Mouse NM_001033174.1

Mus musculus oxysterol binding protein (Osbp), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Osbp (76303)
Length:
4590
CDS:
98..2515

Additional Resources:

NCBI RefSeq record:
NM_001033174.1
NBCI Gene record:
Osbp (76303)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033174.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251257 TAAGATCCCAATGCCGGTAAA pLKO_005 1387 CDS 100% 10.800 8.640 N Osbp n/a
2 TRCN0000251256 CCAGGGAGCTAACCCATATTT pLKO_005 2430 CDS 100% 15.000 10.500 N Osbp n/a
3 TRCN0000251260 CCTTGGTTGAGGGTCATAAAT pLKO_005 4037 3UTR 100% 15.000 10.500 N Osbp n/a
4 TRCN0000251258 GAGAACCAGAATACCATATAA pLKO_005 1306 CDS 100% 15.000 10.500 N Osbp n/a
5 TRCN0000251259 CATCCAATGCCATGATCAATG pLKO_005 894 CDS 100% 10.800 7.560 N Osbp n/a
6 TRCN0000151689 CAACATTATTGTGGGCAAGTT pLKO.1 1840 CDS 100% 4.950 3.465 N OSBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033174.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14725 pDONR223 87.4% 90.2% 21.1% None (many diffs) n/a
2 ccsbBroad304_14725 pLX_304 0% 90.2% 21.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477852 GCTGCAAGAAGAAAACGAGCGTAA pLX_317 10% 90.2% 21.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV