Transcript: Mouse NM_001033222.3

Mus musculus PDZ domain containing 8 (Pdzd8), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Pdzd8 (107368)
Length:
7076
CDS:
194..3637

Additional Resources:

NCBI RefSeq record:
NM_001033222.3
NBCI Gene record:
Pdzd8 (107368)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033222.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424009 ACGTACTCCAACAACACTTTC pLKO_005 1744 CDS 100% 10.800 15.120 N Pdzd8 n/a
2 TRCN0000028258 CGGGAATCGAAGATATTGAAA pLKO.1 3459 CDS 100% 5.625 7.875 N Pdzd8 n/a
3 TRCN0000028234 CGTTTACTAAATCTGCGTCAA pLKO.1 3002 CDS 100% 4.050 5.670 N Pdzd8 n/a
4 TRCN0000421595 CTATTAAGACGGTTGAATTAA pLKO_005 1278 CDS 100% 15.000 12.000 N Pdzd8 n/a
5 TRCN0000431056 GAGCAACTGAGAGGCGAATAG pLKO_005 2847 CDS 100% 10.800 7.560 N Pdzd8 n/a
6 TRCN0000028303 CGGCTTAAAGTTACATTGTTA pLKO.1 1154 CDS 100% 5.625 3.938 N Pdzd8 n/a
7 TRCN0000028219 CCCAGTTACAAGATCAGGTTT pLKO.1 1046 CDS 100% 4.950 3.465 N Pdzd8 n/a
8 TRCN0000028267 CCTACTAAAGACTCTTCAGAT pLKO.1 2174 CDS 100% 4.950 3.465 N Pdzd8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033222.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04735 pDONR223 100% 86.6% 86.6% None (many diffs) n/a
2 ccsbBroad304_04735 pLX_304 0% 86.6% 86.6% V5 (many diffs) n/a
3 TRCN0000492331 TCCCTGAGGAAGGAACTCCTAATC pLX_317 10.8% 86.6% 86.6% V5 (many diffs) n/a
Download CSV