Transcript: Mouse NM_001033268.2

Mus musculus family with sequence similarity 120, member A (Fam120a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Fam120a (218236)
Length:
4919
CDS:
1..3339

Additional Resources:

NCBI RefSeq record:
NM_001033268.2
NBCI Gene record:
Fam120a (218236)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033268.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074922 GCCTTGAATAATGACTCTAAA pLKO.1 3220 CDS 100% 13.200 18.480 N FAM120A n/a
2 TRCN0000346019 TGCTGCGTCTTACGGTATATG pLKO_005 2140 CDS 100% 13.200 18.480 N Fam120a n/a
3 TRCN0000346070 ATAGGCCAGTTCGTCAGTATG pLKO_005 1799 CDS 100% 10.800 8.640 N Fam120a n/a
4 TRCN0000346094 TAAGAGAGCAGTTGGATATTA pLKO_005 963 CDS 100% 15.000 10.500 N Fam120a n/a
5 TRCN0000346000 TCAAAGCCGTAGCTGATTATG pLKO_005 848 CDS 100% 13.200 9.240 N Fam120a n/a
6 TRCN0000283467 CCGTTTGGAATATCAACATTA pLKO_005 4373 3UTR 100% 13.200 7.920 N Fam120a n/a
7 TRCN0000074919 CGTGCAATACAAATCCTCATT pLKO.1 3242 CDS 100% 4.950 6.930 N FAM120A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033268.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07851 pDONR223 100% 91.4% 96.4% None (many diffs) n/a
2 ccsbBroad304_07851 pLX_304 0% 91.4% 96.4% V5 (many diffs) n/a
3 TRCN0000476487 TTGCCACTAGACTTATAACTTATA pLX_317 9.1% 91.4% 96.4% V5 (many diffs) n/a
4 ccsbBroadEn_02734 pDONR223 100% 91.4% 96.4% None (many diffs) n/a
5 ccsbBroad304_02734 pLX_304 0% 91.4% 96.4% V5 (many diffs) n/a
6 TRCN0000480694 ATACAGGGTGCACGCCTTGCGCGT pLX_317 13.6% 91.4% 96.4% V5 (many diffs) n/a
Download CSV