Transcript: Mouse NM_001033273.2

Mus musculus RIKEN cDNA 5031439G07 gene (5031439G07Rik), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
5031439G07Rik (223739)
Length:
5032
CDS:
171..1514

Additional Resources:

NCBI RefSeq record:
NM_001033273.2
NBCI Gene record:
5031439G07Rik (223739)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033273.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283452 CAAGTACACAACTAGACATTT pLKO_005 3550 3UTR 100% 13.200 18.480 N 5031439G07Rik n/a
2 TRCN0000346014 GTGTACCGGAGAGACTCTAAG pLKO_005 546 CDS 100% 10.800 15.120 N 5031439G07Rik n/a
3 TRCN0000267147 ACAGCTTTGAGGAGGTGTTTA pLKO_005 805 CDS 100% 13.200 9.240 N 5031439G07Rik n/a
4 TRCN0000346006 ATGGCCCAGAAGATGTCATTT pLKO_005 978 CDS 100% 13.200 9.240 N 5031439G07Rik n/a
5 TRCN0000345999 TGCCGCTGCATCGGATCTTAA pLKO_005 1450 CDS 100% 13.200 9.240 N 5031439G07Rik n/a
6 TRCN0000160345 CTTCTTCATGATTGACAGCTT pLKO.1 791 CDS 100% 2.640 1.848 N KIAA0930 n/a
7 TRCN0000164209 CAACATGGAGTTTGTGCGCAT pLKO.1 1016 CDS 100% 2.160 1.512 N KIAA0930 n/a
8 TRCN0000134892 CCCAACATCTTCTTCATGATT pLKO.1 783 CDS 100% 5.625 3.375 N KIAA0930 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033273.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11718 pDONR223 100% 73.7% 79.9% None (many diffs) n/a
2 ccsbBroad304_11718 pLX_304 0% 73.7% 79.9% V5 (many diffs) n/a
3 TRCN0000469558 CATGGACCTATTCTGCATCAAGCG pLX_317 39.9% 73.7% 79.9% V5 (many diffs) n/a
Download CSV